Cell membrane localization signal peptide and its coding sequence and use. (2023)

Example 1 Identification of Transit Signal Peptide

1. Construction of recombinant plasmids

1. DNA template preparation: Genomic DNA of Edwardsiella tarda LSE40 was extracted.

2. PCR amplification: using the DNA in step 1 as a template, 108For (AT CATATG CCTTGGATGCCACGATTGC, the underline is the NdeI restriction site) and 108Rev (GAATTC TCGGCCTTGGCCTTTTGCTCGGCCT, the underline is the EcoRI restriction product) to obtain the PCR digestion product. The size is 324 bp. The PCR amplification system (50 µL) is: 5 µL of 10 × buffer, 5 µL of MgCl 2 (25 mM), 1 µL of dNTP mix (10 mMeach), 0.5 µL of PfuTaq polymerase (5U/µL), 108 µL (10 µL), 1 μl of 108Rev (10 μM), 1 μl of DNA template, and ddH 2 O for the rest. The PCR amplification conditions were: 94°C, 5 min; 35 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds; 72°C for 10 minutes.

3. Digestion: Digest the PCR product in step 2 with NdeI and EcoRI restriction endonucleases (37°C, 4 hours) to obtain the digested product. Simultaneously, plasmid pCX341 was double-digested with restriction endonucleases NdeI and EcoRI to obtain an approximately 10-fold linear plasmid DNA fragment. 5600 bp were recovered.

4. Ligation: Ligate the PCR digest product in step 3 with the linear DNA of pCX341 to obtain recombinant plasmid pCX108. The map of plasmid pCX108 is shown in Figure 1. After plasmid pCX108 was digested with NdeI and EcoRI, a DNA fragment of SEQ ID No. 324 bp was obtained. 1 (Fig. 2) was obtained. According to the sequencing results, the structural features of the recombinant plasmid pCX108 are described as follows: Sequence 1 in the sequence table is inserted between the NdeI and EcoRI restriction sites of the plasmid pCX341, such as the 1-324 nucleotides of the 5' end DNA molecule (by Express a fragment consisting of the first to the 108th amino acid residue at the N-terminal of SEQIDNo.2 in the sequence table, named as 108aa), the DNA molecule forms a fusion DNA molecule with the β-lactamase gene on the plasmid pCX341, It expresses a fusion protein of 108aa and β-lactamase, named 108aa-TEM1.

SEC Number 1

[0040] ATGCCTTGGATGCCACGATTGCGCTGTGCTATGGCCAGGCCGACGGCAACCCAGGCTATACACTGCTGCGCCAGCGGGCACAGGGATCTGCTGGATACGCTTAATCAACCCTAAGGAGCCTATGATGATCAACGGCGTTTTCACCGATGCACCGCTGCCGCCACCACCCACCGCCGGGGCCGGCCGGCCCCCCCCGATCGGGG 广告ACCTGCTGGGCATAGAGG CGCCGCGCAGCCGAGCGCCGGGGGCCTCAGCGCCCCTGGACCAGCTCAGGGCACAGGCGCAGGAGGCCGAGCAAAAGGCCAAGGCC

Sequence features:

Length: 324 base pairs

Type: amino acid sequence

Chain Type: Simple Chain

Topology: Linear

Molecule Type: Protein Primary Structure

Specific name: amino acid residue sequence EseG1-108

[0058] 原文：Edwardsiella takes LSE40

2. Fusion protein secretion and expression detection

1. Construction of fusion proteins expressing Edwardsiella tarda

1.1 Preparation of competent bacteria: Cultivate Edwardsiella tarda LSE40 with TSB broth (purchased from Sigma), culture at 25°C for 24-36 hours, centrifuge at 4000g for 10 minutes at 4°C, dry and collect. Talin, washed three times with glycerol saline (30ml glycerol, 100ml distilled water) at 4-8°C, and resuspended at a concentration of 1×108 cells/ml, the obtained cell suspension is the competent bacteria.

1.2 Transformation: The engineered recombinant plasmid pCX108 was electroporated to transform the competent bacteria obtained in 1.1, and the transformed bacteria were cultured in TSA medium (purchased from Sigma) containing 10 μg/ml tetracycline for 36-48 hours, and the cells containing the recombinant were examined plasmid. Edwardsiella tarda colonies produce LSE40pCX108. Edwardsiella tarda containing plasmid pCX341 was screened in the same way as a blank control, named LSE40pCX341.

2. Extraction of Bacterial Extracellular Protein (ECP) and Total Cellular Protein (TCP)

LSE40pCX108 and LSE40pCX341 were respectively inoculated in DMEM medium (purchased from Gibco) at 25°C and 5% CO 2 , and grown for 24-36 hours. Part of the bacteria was taken at 4000g and centrifuged at 4°C for 10 minutes. The supernatant was filtered through a 0.22 µm micropore Membrane filtration, filtrate is extracellular protein (ECP) components; corresponding bacteria. The pellet was resuspended in PBS (pH 7.4) and sonicated, centrifuged at 12,000 g for 5 min at 4 °C and the supernatant collected to obtain the total cellular protein (TCP) fraction. Add the above two components into frozen trichloroacetic acid to a final concentration of 10%, place on ice for 1-2 hours, centrifuge at 12,000 g at 4°C for 20 minutes, wash the precipitate with ice-cold acetone 3 times, and let air dry. An appropriate amount of PBS (pH 7.4) was used to dissolve the precipitate for washing to obtain an ECP protein solution and a TCP protein solution, respectively.

3. Detection of Fusion Proteins

After SDSPage electrophoresis, transfer the ECP and TCP obtained in step 2 to a 0.45 µm PVDF membrane (purchased from Roche), using mouse anti-TEM1 monoclonal antibody as the primary antibody (purchased from Roche for QEBioscience) and horseradish peroxidase . Use labeled goat anti-mouse IgG as the secondary antibody (purchased from Bost Biotech) for Western Blot detection, and the results are shown in Figure 3. Positive hybridization bands of the fusion protein can be detected in both ECP and TCP of LSE40pCX108, indicating that The 108aa-TEM1 fusion protein was expressed in Edwardsiella cells and secreted to the outside of bacterial cells; a protein-positive hybridization band was detected in the TCP of LSE40pCX341, but not in the ECP, indicating that TEM1 was in Edwardsiella It is expressed in bacterial cells, but cannot be secreted outside bacterial cells.

3. Localization of fusion protein in Hela cells

Infect Hela cells with LSE40pCX108 and detect the localization of fusion protein in Hela cells. The specific method is:

1. Hella cell culture: Digest single-cell HeLa cells with 0.25% trypsin, resuspend to a cell concentration of 2 x 10 5 cells/mL, inoculate on a cell culture plate, and incubate at 35°C, 5% CO 2 for 24 hours until the cells attach.

2. Cultivation of recombinant bacteria: Inoculate LSE40pCX341 and LSE40pCX108 in TSB medium respectively, culture on a shaker at 25°C for 18 hours, and transfer the bacterial solution to fresh TSB medium at a ratio of 1:20 (v:v). After culturing for 5 hours, take the bacterial solution and centrifuge at 4°C for 10 minutes to collect the bacterial cells, resuspend in DMEM medium, wash by centrifugation for 3 times, and resuspend in DMEM medium to adjust the bacterial concentration to 108/ml.

3. Infect HeLa cells with the recombinant bacteria: add the bacterial suspension obtained in step 2 to the HeLa cells prepared in step 1, the multiplicity of infection (MOI) ratio is 10:1 (v:v), 35°C, 5% Replace with fresh DMEM medium (containing 200 μg/ml gentamycin) after CO 2 culture for 5 hours, and replace with fresh DMEM medium (containing 16 μg/ml gentamicin) after 1 hour of culture. mL gentamicin) and incubated for 18 hours. Hour.

4. Extraction and detection of various components of HeLa cells: carefully discard the HeLa cell culture medium in step 3, wash the cells 3 times with PBS, collect HeLa cells, add 5 mL of buffer HB (1 M sucrose, 14.8 mL Double-distilled water, 0.2 mL of 300 mM imidazole, 200 µL of 100 mMPMSF), washed 3 times at 1500 g, centrifuged at 4 °C for 15 minutes, dried to collect the cell pellet, resuspended in 1 mL of HB buffer, and used a 1 mL syringe until completely Destroy to obtain cell lysate, centrifuge at 1500 g at 4°C for 20 min, transfer the supernatant to an ultracentrifuge tube, and centrifuge at 40,000 g at 4°C for 60 min, the supernatant is the mass phase of HeLa cells; take the precipitate and use HB buffer Wash twice, add to the supernatant, and resuspend the volume of HB buffer, as the membrane phase of HeLa cells. Western blot detection was performed on the phase separation protein of HeLa cells, and the results are shown in Figure 4. In HeLa cells infected with LSE40pCX108, a positive band of 108aa-TEM1 fusion protein was detected on the phase membrane, but no positive band of 108aa-TEM1 was detected on the phase membrane. Plasma phase; while HeLa cells infected with LSE40pCX341, no positive band of 108aa-TEM1 fusion protein was detected in both membrane phase and bulk phase. These results indicated that the recombinant plasmid pCX108 localized TEM1 to the Hela cell membrane.